Journal: Scientific Reports

Article Title: Beta-Glycerophosphate-Induced ORAI1 Expression and Store Operated Ca 2+ Entry in Megakaryocytes

doi: 10.1038/s41598-020-58384-x

Figure Lengend Snippet: ß-glycerophosphate-sensitive NFAT5, SGK1, ORAI1, ORAI2, STIM1, STIM2 and FGF23 transcription in megakaryocytes ( A–E ). Arithmetic means (±SEM, n = 4–7) of NFAT5 ( A ), SGK1 ( B ), ORAI1 ( C ), ORAI2 ( D ), ORAI3 ( E ), STIM1 ( F ), STIM2 ( G ) and FGF23 ( H ) transcript levels in megakaryocytes without (white bars) and with (black bars) prior exposure to 2 mM ß-glycerophosphate for 24 hours. *(p < 0.05), **(p < 0.01) indicates statistically significant difference to respective value without prior ß-glycerophosphate treatment (Student’s t-test).

Article Snippet: For Western blotting 50 μg of protein were electro-transferred onto a nitrocellulose membrane after electrophoresis using 12% SDS- PAGE and blocked with 5% milk in TBST at room temperature for 1 h. The membranes were incubated with primary anti-NFAT5 antibody (1:1000, Novus Biologicals), anti-ORAI1 antibody (1:1000, Proteintech, Chicago, USA) and anti-GAPDH antibody (1:1000, Cell Signaling, Danvers, USA) at 4 °C overnight.

Techniques:

Journal: Scientific Reports

Article Title: Beta-Glycerophosphate-Induced ORAI1 Expression and Store Operated Ca 2+ Entry in Megakaryocytes

doi: 10.1038/s41598-020-58384-x

Figure Lengend Snippet: NFAT5, SGK1, ORAI1, STIM1, ORAI2 transcript levels in platelets from control volunteers and patients with chronic kidney disease. ( A–G ). Single values and arithmetic means (±SEM) of ( A ) NFAT5, ( B ) SGK1, (C) ORAI1, ( D ) ORAI2, ( E ) ORAI3, ( F ) STIM1, and ( G ) STIM2 transcript levels in platelets drawn from control volunteers (white circles) or patients with impaired kidney function (black squares).

Article Snippet: For Western blotting 50 μg of protein were electro-transferred onto a nitrocellulose membrane after electrophoresis using 12% SDS- PAGE and blocked with 5% milk in TBST at room temperature for 1 h. The membranes were incubated with primary anti-NFAT5 antibody (1:1000, Novus Biologicals), anti-ORAI1 antibody (1:1000, Proteintech, Chicago, USA) and anti-GAPDH antibody (1:1000, Cell Signaling, Danvers, USA) at 4 °C overnight.

Techniques: Control

Journal: Scientific Reports

Article Title: Beta-Glycerophosphate-Induced ORAI1 Expression and Store Operated Ca 2+ Entry in Megakaryocytes

doi: 10.1038/s41598-020-58384-x

Figure Lengend Snippet: Correlation between GFR and NFAT5, SGK1, ORAI1, STIM1, ORAI2 transcript levels in platelets from control volunteers and patients with chronic kidney disease. ( A–G ). Single values of ( A ) NFAT5, ( B ) SGK1, (C) ORAI1, ( D ) ORAI2 ( E ), Orai3 ( F ), STIM1, and ( G ) STIM2 transcript levels in platelets drawn from control volunteers (white circles) or patients with impaired kidney function (black circles) as a function of GFR.

Article Snippet: For Western blotting 50 μg of protein were electro-transferred onto a nitrocellulose membrane after electrophoresis using 12% SDS- PAGE and blocked with 5% milk in TBST at room temperature for 1 h. The membranes were incubated with primary anti-NFAT5 antibody (1:1000, Novus Biologicals), anti-ORAI1 antibody (1:1000, Proteintech, Chicago, USA) and anti-GAPDH antibody (1:1000, Cell Signaling, Danvers, USA) at 4 °C overnight.

Techniques: Control

Journal: Scientific Reports

Article Title: Beta-Glycerophosphate-Induced ORAI1 Expression and Store Operated Ca 2+ Entry in Megakaryocytes

doi: 10.1038/s41598-020-58384-x

Figure Lengend Snippet: NFAT5 and ORAI1 protein abundance in platelets from control volunteers and patients with chronic kidney disease. ( A–C ). Original Western blots of ( A ) NFAT5 and (C) ORAI1 protein abundance in platelets drawn from control volunteers ( B–D ). Arithmetic means (±SEM) of ( B ) NFAT5 and (D) ORAI1 protein abundance in platelets drawn from control volunteers (white circles) or patients with impaired kidney function (black squares).

Article Snippet: For Western blotting 50 μg of protein were electro-transferred onto a nitrocellulose membrane after electrophoresis using 12% SDS- PAGE and blocked with 5% milk in TBST at room temperature for 1 h. The membranes were incubated with primary anti-NFAT5 antibody (1:1000, Novus Biologicals), anti-ORAI1 antibody (1:1000, Proteintech, Chicago, USA) and anti-GAPDH antibody (1:1000, Cell Signaling, Danvers, USA) at 4 °C overnight.

Techniques: Quantitative Proteomics, Control, Western Blot

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: NFAT5 translocates to the nucleus upon hyperosmolarity. Immunofluorescence analysis of HUASMCs treated with control medium (A), 30 mmol/L NaCl (B) and 70 mmol/L NaCl (C) for 24 hours. Quantification of NFAT5‐positive nuclei (D) (n=3, *** P <0.001 vs control; scale bar: 50 μm). HUASMCs indicates human arterial smooth muscle cells; NFAT5, nuclear factor of activated T‐cells 5.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Immunofluorescence

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: Nuclear factor of activated T cells 5 (NFAT5) translocates to the nucleus upon stretch Immunofluorescence analysis of control (A) and stretch‐stimulated (B) HUASMCs for 24 hours (0.5 Hz, 0% to 13% elongation) shows an increase in NFAT5‐specific immunofluorescence in the nuclei. Quantification of NFAT5‐positive nuclei (C, *** P <0.001 vs control, n=6 for all experimental groups, scale bar: 50 μm). Western blot analyses of nuclear extracts (H‐H3: histone H3) from these cells show a stretch‐induced increase in the abundance of NFAT5 in the nuclei (D, * P <0.05 vs control, n=3 for all experimental groups). HUASMCs indicates human arterial smooth muscle cells; NFAT5, nuclear factor of activated T‐cells 5.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Immunofluorescence, Western Blot

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: Validation of NFAT5 knockdown efficiency. HUASMCs were treated with control siRNA and NFAT5 siRNA or left untreated. NFAT5 knockdown efficiency was verified by RT‐PCR analysis after 2 days (A) and by Western blot analysis after 3 days. B, In a similar experiment, immunofluorescence anaylsis was performed with HUASMCs stretched for 24 hours 3 days after transfection of control siRNA (C) or NFAT5 siRNA (D) to show the knockdown efficiency for the microarray setup under these conditions (scale bar=50 μm). HUASMCs indicates human arterial smooth muscle cells; NFAT5, nuclear factor of activated T‐cells 5; RPL32, ribosomal protein L32.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Reverse Transcription Polymerase Chain Reaction, Western Blot, Immunofluorescence, Transfection, Microarray

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: ERK1/2, p38 MAPK and calcineurin are not involved in stretch‐induced translocation of NFAT5 . Immunofluorescence analysis of HUASMCs stretched for 24 hours and treated with DMSO (A) or 50 μmol/L PD98059 (B, scale bar: 50 μm), an inhibitor of the ERK1/2 pathway. Quantification of NFAT5‐positive nuclei (C, n=3). Immunofluorescence analysis of HUASMCs stretched for 24 hours and treated with DMSO (D) or 20 μmol/L SB202190 (E, scale bar: 50 μm), a specific inhibitor of p38 MAP kinase. Quantification of NFAT5‐positive nuclei (F, n=3). Immunofluorescence analysis of HUASMCs stretched for 24 hours and treated with DMSO (G and I) or 10 μmol/L cyclosporin A (H and J), an inhibitor of calcineurin. Quantification of NFAT5‐positive nuclei (K, * P <0.05 vs corresponding DMSO or cyclo A control, bars represent the mean of 1 experiment ±SD performed in triplicates). DMSO indicates Dimethylsulfoxide; ERK1/2, extracellular‐regulated kinase 1/2; HUASMCs, human arterial smooth muscle cells; NFAT5, nuclear factor of activated T‐cells 5.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Translocation Assay, Immunofluorescence

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: JNK inhibition by SP600125 decreases stretch‐induced protein abundance and translocation of NFAT5. Immunofluorescence analyses of HUASMCs (A and B static cell culture) exposed to biomechanical stretch for 24 hours revealed a decrease in the number of NFAT5 positive nuclei in the presence of 20 μmol/L SP600125 (D) as compared to untreated (C) cells (E, * P <0.05 vs DMSO stretch, n=3 for all experimental groups). As evidenced by corresponding Western blot analyses, the phosphorylation of JNK‐p46 and JNK‐p54 is increased in HUASMCs exposed to biomechanical stretch for 1 hour (F, *** P <0.05 vs control, n=3 for all experimental groups, scale bar: 50 μm). Semiquantitative PCR‐analyses revealed an increase in NFAT5 expression in SMCs exposed to biomechanical stretch for 24 hours, which is not inhibited by SP600125 (G, * P <0.05 vs DMSO, n=6 for both experimental groups; not significant (n.s.) vs stretch, n=6 for both experimental groups; n=4 for SP600125). The stretch‐mediated increase in the overall NFAT5 protein abundance was blocked by SP600125 as evidenced by Western blot analyses (H, * P <0.05 vs DMSO, ## P <0.01 vs stretch, n=3 for all comparison groups). HUASMCs indicates human arterial smooth muscle cells; JNK, c‐Jun‐N‐terminal kinase; NFAT5, nuclear factor of activated T‐cells 5; RPL32, ribosomal protein L32.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Inhibition, Translocation Assay, Immunofluorescence, Cell Culture, Western Blot, Expressing

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: Stretch‐dependent phosphorylation of NFAT5. HUASMCs were exposed to biomechanical stretch for 24 hours and lysed. Immunoprecipitation was performed by incubating the protein samples with anti‐NFAT5 antibodies for 2 hours at room temperature which were then captured by protein A‐agarose beads. After washing, the proteins were eluted from the beads, separated by SDS‐PAGE, blotted onto nitrocellulose membranes and analyzed by chemiluminescence‐based immunodetection. Analysis of changes in the phosphorylation of NFAT5 revealed that its total serine phosphorylation does not change upon stretch exposure (A) while individual serine residues such as S1197 become phosphorylated (B, * P <0.05 vs control, n=3; anti‐NFAT5 pS1198 antibody was from Abcam, Cambridge, UK). Stretch‐induced S1197 phosphporylation is inhibited by blocking JNK‐activity with SP600125. C, Immunofluorescence‐based detection of S1197‐phosphorylated NFAT5 indicates that it does not enter the nucleus (D, arrows) but accumulates in the cytoplasm of stretch‐stimulated (6 and 24 hours) HUVSMCs (D, * P <0.05 vs control, n=3 to 6). HUASMCs indicates human arterial smooth muscle cells; JNK, c‐Jun‐N‐terminal kinase; NFAT5, nuclear factor of activated T‐cells 5; PAGE, polyacrylamide gel electrophoresis; SDS, sodium dodecyl sulfate.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Immunoprecipitation, SDS Page, Immunodetection, Blocking Assay, Activity Assay, Immunofluorescence, Polyacrylamide Gel Electrophoresis

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: Inhibition of palmitoylation by 2‐bromopalmitate has no impact on the increased protein abundance of NFAT5 in stretch‐stimulated SMCs. HUASMCs were exposed to biomechanical stretch for 24 hours and treated with 2‐bromopalmitate (100 μmol/L) to inhibit protein palmitoylation. Western blot analyses of whole cell lysates indicated that the NFAT5 protein abundance is increased in stretch‐stimulated HUASMCs and not affected by 2‐bromopalmitate (** P <0.01 vs DMSO, # P <0.01 vs DMSO, not significant (n.s.) vs stretch, n=3). HUASMCs indicates human arterial smooth muscle cells; NFAT5, nuclear factor of activated T‐cells ; SMC, smooth muscle cells.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Inhibition, Western Blot

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: NFAT5 translocation depends on palmitoylation. Immunofluorescence images of stretch‐stimulated HUASMCs pretreated with DMSO as control (A) or 100 μmol/L 2‐bromopalmitate (B), an inhibitor of the DHHC family palmitoyl transferases (protein palmitoylation). Quantification of NFAT5‐positive nuclei (C, * P <0.05 vs control, n=3 for all experimental groups). Western blot analyses of nuclear extracts from HUASMCs exposed to stretch for 24 hours show a decline in nuclear NFAT5 abundance upon 2‐bromopalmitate and SP600125 (20 μmol/L) but not palmostatin B treatment (D, * P <0.05 vs control, n=3 for all experimental groups). In contrast to 2‐bromopalmitate, palmostatin B (13 μmol/L), an inhibitor of protein depalmitoylation, augments stretch‐induced translocation of NFAT5 to the nucleus (E through G, ** P <0.01 vs DMSO with n=6 for the DMSO group and n=5 for the palmostatin group, scale bar: 50 μm). Both inhibitors had no significant effect on the percentage of NFAT5‐positive nuclei in HUASMCs cultured under static conditions (H, n=3 for all experimental groups). HUASMCs indicates human arterial smooth muscle cells; NFAT5, nuclear factor of activated T‐cells.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Translocation Assay, Immunofluorescence, Western Blot, Cell Culture

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: Stretch induces NFAT5 palmitoylation. Exposure to biomechanical stretch promotes a slower electrophoretic migration speed of NFAT5 resulting in a band shift of about 5 kDa (see also Figures A and B) which disappears upon treatment with 2‐bromopalmitate (A, * P <0.05 vs stretch, n=3). HUASMCs were incubated with fatty‐acid free BSA, treated with 100 μmol/L 17‐octadecynoic acid (Cayman Chemical) to label palmitoylated proteins (control was left untreated) and exposed to biomechanical stretch for 24 hours (13% elongation, 0.5 Hz) or cultured under static conditions. Afterwards, proteins were isolated and excess 17‐octadecynoic acid was removed by chloroform/methanol extraction. Standard click chemistry (Martin et al, Nat Methods . 2009;6:135‐138) was performed for 90 minutes utilizing 1 to 2 mg/mL protein, 100 μmol/L biotin‐azide (in DMSO), 1 mmol/L Tris(2‐carboxyethyl)phosphine (in water), 100 μmol/L Tris[(1‐benzyl‐1H‐1,2,3‐triazol‐4‐yl)methyl]amine (in DMSO/t‐butanol, 20%/80%), and 1 mmol/L CuSO 4 (in PBS). After a second chloroform/methanol extraction, biotinylated and thus palmitoylated proteins were captured by streptavidin agarose beads. After rinsing, proteins were eluted from the beads, separated by SDS‐PAGE, blotted onto nitrocellulose membranes and analyzed by chemiluminescence‐based immunodetection. NFAT5 was only detected in stretch‐stimulated HUASMCs as evidenced by Western blot analysis indicating its palmitoylation. β‐actin was detected in the flowthrough by standard Western blot analysis to verify that comparable amounts of proteins had been applied. BSA indicates bovine serum albumin; HUASMCs, human arterial smooth muscle cells; NFAT5, nuclear factor of activated T‐cells; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate buffered saline: SDS, sodium dodecyl sulfate.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Migration, Electrophoretic Mobility Shift Assay, Incubation, Cell Culture, Isolation, SDS Page, Immunodetection, Western Blot, Polyacrylamide Gel Electrophoresis

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: Microarray analysis of stretch‐dependent NFAT5 target genes. Layout of an Affymetrix microarray‐based analysis of gene products whose expression is significantly up‐ or downregulated in stretch‐stimulated (24 hours) HUASMCs transfected with control or NFAT5‐specific siRNA. A heat map was generated from the statistical microarray data comparing HUASMCs transfected with control or NFAT5 siRNA. Each square represents the mean value of 3 replicates. Colors represent log2 values from −2 to 2. HUASMCs indicates human arterial smooth muscle cells; NFAT5, nuclear factor of activated T‐cells.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Microarray, Expressing, Transfection, Generated

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: Transcriptional targets of NFAT5 upon biomechanical stretch. Volcano plot analysis of transcriptome changes (fold expression level vs calculated probability value) in HUASMCs transfected with control or NFAT5 siRNA shows nearly 2000 differently regulated genes for P <0.005 (A, n=3 for all experimental groups). Verification of 4 microarray targets by RT‐PCR (B, ** P <0.01, *** P <0.001 vs control, n=3 for all experimental groups). There are 7 putative NFAT5 binding sites in the human tenascin‐C promotor as evidenced by in silico analysis of the first 3512 bp of the promoter sequence upstream of the transcription start site. C, The maximum core similarity (core similarity of 1.0) is only reached when the highest conserved bases of a matrix are exactly matched by the sequence (cf. capitals in the sequence). A good match to the matrix has a similarity of >0.80 (matrix similarity). Based on a ChIP DNA fragment length in the range of 500 to 800 bp the primer pair used for ChIP analysis (651 to 807 bp) focuses on the NFAT5 binding site no. 1 (819 to 837 bp). Exemplary ChIP analysis functionally verified the stretch‐induced binding of NFAT5 to this site (D, ChIP DNA panel). Total input DNA serves as a control to verify that almost equal DNA amounts were used for the analysis. The no‐antibody‐control (NAC) reveales all non‐specifically precipitated chromatin species, the IgG control unspecific antibody binding. ACTBL2 indicates actin, beta‐like 2; ChIP, chromatin immune‐precipitation; HUASMCs, human arterial smooth muscle cells; JAM3, junctional adhesion molecule 3; NFAT5, nuclear factor of activated T‐cells; RARB, retinoic acid receptor beta; TNC, tenascin‐C.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Expressing, Transfection, Microarray, Reverse Transcription Polymerase Chain Reaction, Binding Assay, In Silico, Sequencing

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: Transcriptional Targets of NFAT5 in Stretch‐Stimulated HUASMCs

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Expressing, Histone Deacetylase Assay, Sequencing, Binding Assay

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: In Silico Tenascin‐C Promotor Analysis

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: In Silico, Sequencing

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: Attenuation of TNC mRNA expression in stretch‐stimulated HUASMCs upon NFAT5‐dODN treatment. HUASMCs were pretreated (10 μmol/L) with control deoxyoligonucleotides (ODNscr; ODNscrFor: 5′GAGTGAAGGCATACTGACTC′3, ODNscrRev: 5′GAGTCAGTATGCCTTCACTC′3; 5′/3′‐ends were modified by phosphorothioate) or decoy oligo‐deoxynucleotides mimicking the NFAT5 binding site (NFAT5‐dODN, NFAT5‐dODNFor: 5′GAGTGGAAACATACTGACTC′3; NFAT5‐dODNRev: 5′GAGTCAGTATGTTTCCACTC′3; 5′/3′‐ends were modified by phosphorothioate) for 3 hours and exposed to biomechanical stretch for 24 hours (0.5 Hz, 0% to 13% elongation). Subsequent PCR analyses revealed that the stretch‐induced increase of tenascin C (TNC) mRNA expression is significantly attenuated in HUASMCs treated with the NFAT5‐dODN (* P <0.05 vs stretch+ODNscr and stretch, 1 out of 2 independent experiments with similar results performed in quadruplicates). HUASMCs indicates human arterial smooth muscle cells; NFAT5, nuclear factor of activated T‐cells; PCR, polymerase chain reaction; RPL32, ribosomal protein L3.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Expressing, Modification, Binding Assay, Polymerase Chain Reaction

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: Inhibition of JNK blocks stretch‐induced RARB and TNC expression. HUASMCs were exposed to biomechanical stretch for 24 hours, treated with DMSO (control) or the JNK inhibitor SP600125 and the mRNA expression of the NFAT5 target genes RARB and tenascin C (TNC) was determined by real time PCR. Stretch up‐regulates RARB and TNC mRNA expression (A and B: * P <0.05 vs DMSO, n=3), which is inhibited upon SP600125 treatment (A and B: # P <0.05 vs stretch+DMSO, n=3). HUASMCs indicates human arterial smooth muscle cells; JNK, c‐Jun‐N‐terminal kinase; NFAT5, nuclear factor of activated T‐cells; PCR, polymerase chain reaction; RARB, retinoic acid receptor beta; RPL32, ribosomal protein L3.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Inhibition, Expressing, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: Dynamics of NFAT5 expression/translocation and TNC expression in stretch‐stimulated HUASMCs. Cells were exposed to biomechanical stretch for 6, 24, and 48 hours (0.5 Hz, 0% to 13% elongation). Western blot analyses of nuclear protein fractions (H‐H3: histone H3) and cytoplasmic protein fractions (A) as well as detection of NFAT5‐specific immunofluorescence in the nuclei (B) reveal a robust nuclear localization of NFAT5 24 hours upon onset of stretch stimulation (A, * P <0.05 vs control; n.s.—not significant vs control; A, n=3 for all experimental groups (repeated measures ANOVA); B, n.s.—not significant vs control, * P <0.05 vs control with n=5 for control, n=3 for 6 hours, n=6 for 24 hours and n=3 for 48 hours). Tenascin‐C (TNC) mRNA expression is significantly increased in HUASMC exposed to stretch for 24 but not 6 hours (C, n.s.—not significant vs control, * P <0.05 vs control, with n=5 for control, n=3 for 6 hours, n=3 for 24 hours, and n=3 for 48 hours; TNC expression was normalized to RPL32 expression). HUASMCs indicates human arterial smooth muscle cells; RPL32, ribosomal protein L3.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Expressing, Translocation Assay, Western Blot, Immunofluorescence

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: Tenascin‐C promotes and partially rescues HUASMC migration upon loss of NFAT5. Cells were stretched for 24 hours and tenascin‐C (TNC) mRNA expression was compared to that of static control cells (A) (* P <0.05 vs control, n=3 for all experimental groups). Spheroid sprouting assay of control and HUASMCs exposed to recombinant human tenascin‐C demonstrates a stimulating effect of tenascin‐C (TNC) on both cell migration and invasion (B through D, ** P <0.01 vs control, n=5 for all experimental groups, scale bar: 100 μm). siRNA‐mediated knockdown of TNC inhibits migration (48 hours) of HUASMCs (E through G, * P <0.05 vs ctr. siRNA, n=5 for all experimental groups). In contrast to control siRNA‐treated HUASMCs, planar migration is inhibited upon NFAT5 silencing as evidenced by quantifying their migration distance 24 and 48 hours after initiating the assay. This is partially rescued by coating the migration surface with recombinant TNC (0.65 μg/cm² rhTNC) (H, *** P <0.001/** P <0.01 vs control siRNA or vs NFAT5 siRNA as indicated, n=4 for all experimental groups). HUASMCs indicates human arterial smooth muscle cells; NFAT5, nuclear factor of activated T‐cells; RPL32, ribosomal protein L3.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Migration, Expressing, Recombinant

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Arterial Wall Stress Controls NFAT5 Activity in Vascular Smooth Muscle Cells

doi: 10.1161/JAHA.113.000626

Figure Lengend Snippet: Hypertension induces NFAT5 translocation and tenascin‐C expression in mouse arteries. Mouse femoral arteries were exposed to normotensive (70 to 50 mm Hg; A, D) and hypertensive (100 to 120 mm Hg; B, E) perfusion conditions. Nuclei were visualized by DAPI staining (A through E, blue fluorescence) and NFAT5 was detected by immunofluorescence analysis (B, red fluorescence, arrows) in cross sections of the arteries. The number of NFAT5‐positive nuclei is increased in high‐pressure perfused arteries (C, *** P <0.001 vs 70 to 50 mm Hg with n=5 for “70 to 50 mm Hg” and n=4 for “120 to 100 mm Hg”). Likewise, the abundance (D through F, red fluorescence, arrow) and mRNA expression (G, real‐time PCR results) of tenascin‐C in the vessel wall is significantly increased under these conditions (F, * P <0.05 vs 70 to 50 mm Hg, n=6 for all experimental groups; scale bar: 100 μm; G, * P <0.05 vs 70 to 50 mm Hg, n=3 for all experimental groups). DAPI indicates 4′,6‐diamidino‐2‐phenylindole; NFAT5, nuclear factor of activated T‐cells; PCR, polymerase chain reaction; TNC, tenascin‐C.

Article Snippet: Primary antibodies: rabbit anti‐NFAT5 1:2000 (Abcam), rabbit anti‐NFAT5 1:500 (Santa Cruz Biotechnology), mouse anti‐β‐actin 1:10 000 (Abcam), anti‐JNK/anti‐phospho (JNK1/2: T183/Y185, JNK3: T221/Y223)‐JNK 1:2000 (R&D systems, Germany), anti‐TNC 1:500 (R&D Systems), anti‐histone H3 (Abcam).

Techniques: Translocation Assay, Expressing, Staining, Fluorescence, Immunofluorescence, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

Journal: Advanced Science

Article Title: Inhibition of NFAT5‐Dependent Astrocyte Swelling Alleviates Neuropathic Pain

doi: 10.1002/advs.202302916

Figure Lengend Snippet: Targeting NFAT5 alleviated CCI‐induced neuropathic pain. A1‐A3) Behavioral tests of paw withdrawal mechanical threshold (PWMT), paw withdrawal thermal latency (PWTL), and spontaneous pain scores after CCI surgery. *** p < 0.001, n = 8, two‐way ANOVA with repeated measures followed by Tukey's multiple comparison test. B1‐B3) NFAT5 protein level in the injured ipsilateral spinal dorsal horn (SDH) and ipsilateral L4‐L5 DRG after sham or CCI surgery. * p < 0.05, ** p < 0.01, n = 6, one‐way ANOVA followed by Tukey's multiple comparison test. C1) Validation of knockdown efficiency after intrathecal ( i.t .) injection of AAV2/9‐sh Nfat5 in rats SDH. * p < 0.05, n = 6, two‐tailed unpaired student's t ‐test. C2‐C3) Rats were i.t . injection of AAV2/9‐sh Nfat5 for 2 weeks followed by CCI modeling and then performed PWMT and PWTL pain behavioral tests. CCI + AAV2/9‐sh Nfat5 versus CCI + AAV2/9‐NC, * p < 0.05, ** p < 0.01, *** p < 0.001, n = 8, two‐way ANOVA with repeated measures followed by Tukey's multiple comparison test. D1‐D3) Behavioral tests of PWMT, PWTL and spontaneous pain scores after daily i.t . administration of the NFAT5 inhibitor KRN2 for 7 days after CCI modeling. CCI + KRN2 (5 µg kg −1 ) versus CCI + Vehicle, * p < 0.05, n = 8, CCI + KRN2 (20 µg kg −1 ) versus CCI + Vehicle, ** p < 0.01, *** p < 0.001, n = 8, two‐way ANOVA with repeated measures followed by Tukey's multiple comparison test. E1‐E2) Behavioral tests of PWMT and PWTL after single i.t . administration of the NFAT5 inhibitor KRN2 on day 7 CCI‐treated rats. CCI + KRN2 (5 µg kg −1 ) versus CCI + Vehicle, * p < 0.05, *** p < 0.001, n = 8, CCI + KRN2 (20 µg kg −1 ) versus CCI + Vehicle, * p < 0.05, ** p < 0.01, *** p < 0.001, n = 8, two‐way ANOVA with repeated measures followed by Tukey's multiple comparison test. E3) Behavioral tests of spontaneous pain scores after single i.t . administration of the NFAT5 inhibitor KRN2 on day 7 CCI‐treated rats. CCI + KRN2 (5 µg kg −1 ) versus CCI + Vehicle, * p < 0.05, n = 8, CCI + KRN2 (20 µg kg −1 ) versus CCI + Vehicle, *** p < 0.001, n = 8, one‐way ANOVA followed by Tukey's multiple comparison test.

Article Snippet: Immunoblots were carried out with primary antibodies, including anti‐NFAT5 (Abcam, ab3446), anti‐AURKB (Abcam, ab2254), anti‐Phospho‐Ser/Thr (Abcam, ab17464), anti‐AQP4 (Abcam, ab2254), anti‐GAPDH (ZENBIO, 20030–67E4), anti‐Histone 3 (CST, 4499s).

Techniques: Comparison, Injection, Two Tailed Test

Journal: Advanced Science

Article Title: Inhibition of NFAT5‐Dependent Astrocyte Swelling Alleviates Neuropathic Pain

doi: 10.1002/advs.202302916

Figure Lengend Snippet: Targeting NFAT5 attenuates astrocyte swelling during neuropathic pain. A1) Representative 3D orthogonal confocal images of GFAP‐stained astrocytes in indicated group of rats SDH. Scale bar = 100 µm. A2‐A3) Morphological changes (average processes length and cell volume) of astrocytes in the SDH. CCI versus sham, ** p < 0.01, *** p < 0.001, CCI + AAV2/9‐NC versus CCI + AAV2/9‐sh Nfat5 , * p < 0.05, ** p < 0.01, n = 30 (3 rats per group, and 10 typical cells per rat were analyzed), one‐way ANOVA followed by Tukey's multiple comparison test. B1) Schematic diagram of astrocytes processes volume fraction estimation, scale bar = 10 µm. B2‐B5) Estimation of astrocytes processes volume fraction. CCI versus sham, * p < 0.05, CCI + AAV2/9‐NC versus CCI + AAV2/9‐sh Nfat5 , * p < 0.05, n = 24 (3 rats per group, and 8 volume fractions of each rat ranged from 5 to 40 µm were analyzed), two‐tailed unpaired student's t ‐test. C1) Schematic diagram of astrocytes Sholl analysis, scale bar = 10 µm. C2‐C3) Sholl analysis of astrocytes. CCI versus sham, * p < 0.05, ** p < 0.01, n = 3, CCI + AAV2/9‐NC versus CCI + AAV2/9‐sh Nfat5 , * p < 0.05, n = 3, two‐way ANOVA followed by Tukey's multiple comparison test. D) Transfection efficiency of intra‐spinal injection of AAV2/5‐sh Nfat5 in the indicated cell types. Quantification of transfection efficiency was shown on the right (pooled from 3 rats/group). Scale bar = 100 µm. E1‐E2) Representative transmission electron microscopy images and average area of the somatic cytoplasm statistics of astrocytes in indicated group of rats SDH after intra‐spinal injection of AAV2/5‐sh Nfat5 . The area within the blue curve indicates astrocytes, the white arrow in the upper panel image indicates the area that is magnified in the lower panel of the image, the yellow arrow indicates cytoplasm or mitochondria without swelling, and the red arrow indicates cytoplasm or mitochondria with obvious swelling. Scale bar = 2 µm. CCI versus sham, ** p < 0.01, CCI + AAV2/5‐NC versus CCI + AAV2/5‐sh Nfat5 , * p < 0.05, n = 3, one‐way ANOVA followed by Tukey's multiple comparison test.

Article Snippet: Immunoblots were carried out with primary antibodies, including anti‐NFAT5 (Abcam, ab3446), anti‐AURKB (Abcam, ab2254), anti‐Phospho‐Ser/Thr (Abcam, ab17464), anti‐AQP4 (Abcam, ab2254), anti‐GAPDH (ZENBIO, 20030–67E4), anti‐Histone 3 (CST, 4499s).

Techniques: Staining, Comparison, Two Tailed Test, Transfection, Injection, Transmission Assay, Electron Microscopy

Journal: Advanced Science

Article Title: Inhibition of NFAT5‐Dependent Astrocyte Swelling Alleviates Neuropathic Pain

doi: 10.1002/advs.202302916

Figure Lengend Snippet: NFAT5 regulates AQP4 expression. A) Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis of ChIP‐seq of NFAT5 targets. B) Heat map showed 144 significantly up‐regulated genes in the SDH of CCI group rats compared with the sham group by RNA‐seq analysis. C1) The intersection of NFAT5 ChIP‐seq data with RNA‐seq data from sham and CCI groups. C2) ChIP‐qPCR analysis of endogenous NFAT5 binding at Aqp4 promoters in the SDH after CCI. *** p < 0.001, n = 3, two‐tailed unpaired Student's t ‐test. C3) Expression of Aqp4 mRNA in the injured ipsilateral SDH after sham or CCI surgery. Compared to the sham‐operated rats, *** p < 0.001, n = 6, one‐way ANOVA followed by Tukey's multiple comparison test. D) Immunofluorescence double‐labeling of AQP4 (green) and astrocyte marker GFAP (red) in the SDH on day 7 after CCI modeling. Scale bar = 100 µm. E1) Aqp4 mRNA expression after i.t . administration of AAV2/9‐sh Nfat5 in the SDH of CCI rats. CCI versus sham, *** p < 0.001, CCI + AAV2/9‐sh Nfat5 versus CCI + AAV2/9‐NC, *** p < 0.001, n = 6, one‐way ANOVA followed by Tukey's multiple comparison test. E2) AQP4 protein expression after i.t . administration of AAV2/9‐sh Nfat5 in the SDH of CCI rats. CCI versus sham, ** p < 0.01, CCI + AAV2/9‐sh Nfat5 versus CCI + AAV2/9‐NC, ** p < 0.01, n = 6, one‐way ANOVA followed by Tukey's multiple comparison test.

Article Snippet: Immunoblots were carried out with primary antibodies, including anti‐NFAT5 (Abcam, ab3446), anti‐AURKB (Abcam, ab2254), anti‐Phospho‐Ser/Thr (Abcam, ab17464), anti‐AQP4 (Abcam, ab2254), anti‐GAPDH (ZENBIO, 20030–67E4), anti‐Histone 3 (CST, 4499s).

Techniques: Expressing, ChIP-sequencing, RNA Sequencing Assay, Binding Assay, Two Tailed Test, Comparison, Immunofluorescence, Labeling, Marker

Journal: Advanced Science

Article Title: Inhibition of NFAT5‐Dependent Astrocyte Swelling Alleviates Neuropathic Pain

doi: 10.1002/advs.202302916

Figure Lengend Snippet: AURKB regulates NFAT5 phosphorylation and its protein level. A) Expression of Nfat5 mRNA in the injured ipsilateral SDH after sham or CCI surgery. B1‐B2) Co‐immunoprecipitation of AURKB and NFAT5 in the SDH of rats after CCI modeling. C) Experimental validation of AURKB regulation of NFAT5 phosphorylation in vitro. D1‐D2) Behavioral tests of PWMT and PWTL after daily i.t . administration of AURKB inhibitor AZD1152 over 7 days post‐CCI modeling. * p < 0.05, ** p < 0.01, *** p < 0.001, n = 6, two‐way ANOVA with repeated measures followed by Tukey's multiple comparison test. E1) Nfat5 mRNA expression in the SDH after daily i.t . administration of AURKB inhibitor AZD1152 in CCI rats. E2) NFAT5 total protein expression in the SDH after daily i.t . administration of AURKB inhibitor AZD1152 in CCI rats. CCI versus sham, * p < 0.05, CCI + AZD1152 versus CCI + Vehicle, * p < 0.05, n = 4, one‐way ANOVA followed by Tukey's multiple comparison test. F1) Cytoplasm and nucleus NFAT5 protein levels after daily i.t . administration of AURKB inhibitor AZD1152 in the SDH of CCI rats. CCI versus sham, * p < 0.05, CCI + AZD1152 versus CCI + Vehicle, * p < 0.05, n = 4, one‐way ANOVA followed by Tukey's multiple comparison test. F2) Nuclear to cytoplasmic ratio of NFAT5 protein of F1, * p < 0.05, CCI + AZD1152 versus CCI + Vehicle, * p < 0.05, n = 4, one‐way ANOVA followed by Tukey's multiple comparison test.

Article Snippet: Immunoblots were carried out with primary antibodies, including anti‐NFAT5 (Abcam, ab3446), anti‐AURKB (Abcam, ab2254), anti‐Phospho‐Ser/Thr (Abcam, ab17464), anti‐AQP4 (Abcam, ab2254), anti‐GAPDH (ZENBIO, 20030–67E4), anti‐Histone 3 (CST, 4499s).

Techniques: Expressing, Immunoprecipitation, In Vitro, Comparison

Journal: Advanced Science

Article Title: Inhibition of NFAT5‐Dependent Astrocyte Swelling Alleviates Neuropathic Pain

doi: 10.1002/advs.202302916

Figure Lengend Snippet: AURKB regulates NFAT5‐AQP4 signaling pathway in astrocytes. A1) Aqp4 mRNA expression in the SDH of CCI rats after daily i.t . administration of AURKB inhibitor AZD1152. CCI versus sham, *** p < 0.001, CCI+ AZD1152 versus CCI+ Vehicle, *** p < 0.001, n = 6, one‐way ANOVA followed by Tukey's multiple comparison test. A2) AQP4 protein expression in the SDH of CCI rats after daily i.t . administration of AURKB inhibitor AZD1152. CCI versus sham, * p < 0.05, CCI + AZD1152 versus CCI + Vehicle, ** p < 0.01, n = 4, one‐way ANOVA followed by Tukey's multiple comparison test. B1) Experimental procedure involved the overexpression of AURKB in CTX‐TNA2 cell line, followed by subsequent administration of the AURKB inhibitor AZD1152 or NFAT5 inhibitor KRN2. B2) The AURKB protein level in the LV‐ Aurkb transfected CTX‐TNA2 cell line. LV‐ Aurkb versus LV‐NC, ** p < 0.01, n = 6, one‐way ANOVA followed by Tukey's multiple comparison test. C1‐C2) The Nfat5 mRNA and protein levels in the LV‐ Aurkb transfected CTX‐TNA2 cells with AURKB inhibitor AZD1152 treatment for 24 h. Control versus LV‐ Aurkb , * p < 0.05, LV‐ Aurkb + Vehicle versus LV‐ Aurkb + AZD1152, ** p < 0.01, n = 4, one‐way ANOVA followed by Tukey's multiple comparison test. C3) The AQP4 protein levels in the LV‐ Aurkb transfected CTX‐TNA2 cells administration with AURKB inhibitor AZD1152 treatment for 24 h. Control versus LV‐ Aurkb , * p <0.05, LV‐ Aurkb + Vehicle versus LV‐ Aurkb + AZD1152, *** p < 0.001, n = 6, one‐way ANOVA followed by Tukey's multiple comparison test. D) The AQP4 protein levels in the LV‐ Aurkb transfected CTX‐TNA2 cells administration with NFAT5 inhibitor KRN2 treatment for 24 h. Control versus LV‐ Aurkb , * p <0.05, LV‐ Aurkb + Vehicle versus LV‐ Aurkb + KRN2, * p < 0.05, n = 6, one‐way ANOVA followed by Tukey's multiple comparison test. E) NFAT5 protein level in cytoplasm and nucleus of AURKB overexpressed CTX‐TNA2 cells, followed with administered AURKB inhibitor AZD1152. Control versus LV‐ Aurkb , ** p <0.01, LV‐ Aurkb + Vehicle versus LV‐ Aurkb + AZD1152, *** p < 0.001, n = 4, one‐way ANOVA followed by Tukey's multiple comparison test.

Article Snippet: Immunoblots were carried out with primary antibodies, including anti‐NFAT5 (Abcam, ab3446), anti‐AURKB (Abcam, ab2254), anti‐Phospho‐Ser/Thr (Abcam, ab17464), anti‐AQP4 (Abcam, ab2254), anti‐GAPDH (ZENBIO, 20030–67E4), anti‐Histone 3 (CST, 4499s).

Techniques: Expressing, Comparison, Over Expression, Transfection

Journal: Advanced Science

Article Title: Inhibition of NFAT5‐Dependent Astrocyte Swelling Alleviates Neuropathic Pain

doi: 10.1002/advs.202302916

Figure Lengend Snippet: Schematic diagram of the NFAT5 signaling pathway regulation in SDH astrocytes during neuropathic pain. Peripheral nerve injury induces morphological changes in SDH astrocytes, characterized by significant cell swelling, a prominent pathological feature in the context of neuropathic pain. The NFAT5 signaling pathway plays a crucial role in astrocyte swelling after peripheral nerve injury. AURKB mediates NFAT5 phosphorylation, promotes NFAT5 translocation into the nucleus and protects it from degradation. The nuclear NFAT5 further stimulates the transcription and expression of AQP4, which subsequently leads to astrocyte swelling and contributes to the development of neuropathic pain.

Article Snippet: Immunoblots were carried out with primary antibodies, including anti‐NFAT5 (Abcam, ab3446), anti‐AURKB (Abcam, ab2254), anti‐Phospho‐Ser/Thr (Abcam, ab17464), anti‐AQP4 (Abcam, ab2254), anti‐GAPDH (ZENBIO, 20030–67E4), anti‐Histone 3 (CST, 4499s).

Techniques: Translocation Assay, Expressing

Journal: bioRxiv

Article Title: Extracellular sodium regulates fibroblast growth factor 23 (FGF23) formation

doi: 10.1101/2023.06.23.546282

Figure Lengend Snippet: A ) Representative immunoblots of NFAT5 and β-actin upon addition of 20 mM NaCl, 40 mM mannitol, and 40 mM urea treatment for 16 h. B) Quantification of NFAT5 protein normalized with β-actin (n=3). C) Fold change Nfat5 mRNA levels; D) cFGF23 levels in cell media; E) Fold change Fgf23 mRNA levels, after treating 20 mM NaCl, 40 mM mannitol, and 40 mM urea for 24 h (n=3-4). F) Lactate dehydrogenase (LDH) release in the cells following 0, 40, 80, 120, and 140 mM +NaCl treatment for 24 h (n=3). G) Fold change Fgf23 and Nfat5 mRNA levels following 0, 2, 5, 10, 20, and 30 mM +NaCl treatment for 24 h (n=4). The black and red stars indicate a statistically significant difference between Nfat5 and Fgf23 mRNA, respectively, when compared to 0 mM +NaCl. H) Fold change Fgf23 and Nfat5 mRNA levels after 20 mM +NaCl treatment over 0-48 h (n=3). The black and red stars indicate a statistically significant difference between Nfat5 and Fgf23 mRNA, respectively, when compared to 0 h (control). All the values are expressed in arithmetic means ± SEM. In cases where the p value is not mentioned, the following applies: ns (not significant) p > 0.05, *p ≤ 0.05, ** p < 0.01, and *** p < 0.001.

Article Snippet: Next, membranes were blocked in Odyssey blocking buffer (LI-COR; Cat. # 927-70001) for 1 hour and incubated with the diluted NFAT5 primary antibody (Thermo Fisher; Cat. #PA1-023) and β-actin (Santa Cruz; Cat. #sc-47778X) overnight at 4°C.

Techniques: Western Blot, Control

Journal: bioRxiv

Article Title: Extracellular sodium regulates fibroblast growth factor 23 (FGF23) formation

doi: 10.1101/2023.06.23.546282

Figure Lengend Snippet: A) Fold change Fgf23 mRNA levels upon treating NaCl-deficient culture media by −5, −10, −15, and −20 mM NaCl for 24 h (n=3). B) Fold change Fgf23 mRNA; C) cFGF23 levels in media; D) Nfat5 mRNA, after treating cells with −20 mM NaCl-deficient culture media. The osmolality was corrected by adding mannitol (40 mM) or urea (40 mM) for 24 h (n=3). All the values are expressed in arithmetic means ± SEM. ns (not significant) p > 0.05

Article Snippet: Next, membranes were blocked in Odyssey blocking buffer (LI-COR; Cat. # 927-70001) for 1 hour and incubated with the diluted NFAT5 primary antibody (Thermo Fisher; Cat. #PA1-023) and β-actin (Santa Cruz; Cat. #sc-47778X) overnight at 4°C.

Techniques:

Journal: bioRxiv

Article Title: Extracellular sodium regulates fibroblast growth factor 23 (FGF23) formation

doi: 10.1101/2023.06.23.546282

Figure Lengend Snippet: A) Original immunoblot of NFAT5 and β-actin after -NaCl (−20 mM) and +NaCl (+20 mM) treatment for 24 h in control and NFAT5 KO cells. B) Nfat5 mRNA levels in control and NFAT5 KO cells after -NaCl and +NaCl treatment for 24 h (n=3). Nfat5 mRNA levels in NFAT5 KO cells were not detected. C) LDH release in cell supernatants treated with different NaCl concentrations (n=3). ***( p < 0.001) indicate statistically significant difference between LDH levels in control and NFAT5 KO cell supernatant at that particular +NaCl concentration. D) Venn diagrams showing a number of upregulated/downregulated genes in -NaCl vs. +NaCl treatment for 24 h. E) Heatmap of gene expression levels in control and NFAT5 KO cells upon -NaCl vs. +NaCl treatment. F) Volcano plot of upregulated/downregulated genes in control cells upon -NaCl vs. +NaCl treatment. These genes were differentially expressed in control, but not in NFAT5 KO cells upon -NaCl vs. +NaCl treatment. G) GO analysis of the upregulated genes in control cells that remain unchanged in NFAT5 KO cells upon - NaCl vs. +NaCl treatment. H) FGF23-regulating genes that are statistically significantly ( p < 0.05) upregulated/downregulated in control cells but remain unchanged in NFAT5 KO cells upon -NaCl vs. +NaCl treatment. I) Phex mRNA levels measured by qRT-PCR upon -NaCl vs. +NaCl for 24 h in UMR-106 cells. Osmolality was corrected to +NaCl by adding mannitol or urea (n=3).

Article Snippet: Next, membranes were blocked in Odyssey blocking buffer (LI-COR; Cat. # 927-70001) for 1 hour and incubated with the diluted NFAT5 primary antibody (Thermo Fisher; Cat. #PA1-023) and β-actin (Santa Cruz; Cat. #sc-47778X) overnight at 4°C.

Techniques: Western Blot, Control, Concentration Assay, Gene Expression, Quantitative RT-PCR

Journal: Cardiovascular Diabetology

Article Title: High glucose-induced hyperosmolarity contributes to COX-2 expression and angiogenesis: implications for diabetic retinopathy

doi: 10.1186/s12933-016-0342-4

Figure Lengend Snippet: The involvement of TonEBP/NFAT5 in glucose-induced endothelial COX-2 expression. a Western analysis of the effect of siRNA to TonEBP/NFAT5 on COX-2 expression in endothelial cells exposed to high glucose and high mannitol. Serum-starved human aortic endothelial cells (HAECs) were transfected with fluorescein isothiocyanate (FITC)-coniugated-siRNA to TonEBP/NFAT5 or siRNA to scrambled sequence for 24 h, and then treated with stimuli for 24 h with high glucose, or high mannitol, or equimolar concentration of sodium chloride. At the end of treatments transfection efficiency was checked by observing the plates under fluorescence microscopy. Protein expressions for cyclooxygenase (COX)-2 was detected by Western analysis, with β-actin serving as loading control. Data represent for each condition the mean ± S.D. from three separate experiments. **, P < 0.01 mannitol- or glucose-treated vs control HAECs; §, P < 0.05 vs without TonEBP/NFAT-siRNA. b The effect of hyperosmotic stress on NF-κB activation in human aortic endothelial cells. Electrophoretic mobility gel shift assay ( EMSA ), showing the effect of hypertonic stress on NF-κB activation. EMSA was performed by mixing the 32 P-oligonucleotide encoding for the NF-κB binding probe with nuclear extracts from osmotically stressed HAECs for 1–3 h. The electrophoretic run with nuclear protein extracts from unstimulated HAECs is shown in lane 1 and lane 7. The supershift analysis with a polyclonal rabbit antibody against p65, shows upward shift of binding complexes. Results are representative of three separate experiments. c Scanning densitometry of the shift bands (highlighted within the rectangle ) of EMSA gels, expressed as arbitrary units of optical density. Data represent for each condition the mean ± S.D. from 3 separate experiments. *, P < 0.01 vs control HAECs

Article Snippet: 15 μg of nuclear extracts used for EMSA and of cytosolic extracts were electroblotted and incubated with either a primary rabbit polyclonal anti-TonEBP (cat. N° sc-13035, dilution 1:500, Santa Cruz), secondary antibody goat anti-rabbit IgG-HRP (cat. N° sc-12304, dilution 1:10,000, Santa Cruz); or an anti-lamin B antibody (Santa Cruz), as previously described [ ].

Techniques: Expressing, Western Blot, Transfection, Sequencing, Concentration Assay, Fluorescence, Microscopy, Control, Activation Assay, Gel Shift, Binding Assay

Journal: Biological Research

Article Title: Placental growth factor mediates pathological uterine angiogenesis by activating the NFAT5-SGK1 signaling axis in the endometrium: implications for preeclampsia development

doi: 10.1186/s40659-024-00526-w

Figure Lengend Snippet: PlGF activates NFAT5 expression and activity in EnSCs. ( a ) NFAT5 mRNA transcript kinetics in EnSCs treated with PlGF for 2, 4 and 6 days at a concentration of 20 ng/ml. L19 was used as a housekeeping gene and the data was normalized to untreated (Con) ( n = 5, **, p < 0.01). ( b ) Original Western blot analysis of NFAT5 protein with GAPDH as loading control in untreated (Con) and PlGF treated EnSCs. ( c ) Average NFAT5 protein levels after 6 days treatment with PlGF ( n = 5, ** p < 0.01). The samples are represented after normalization with untreated control (Con). d ) Immunofluorescence images confirms nuclear translocation of NFAT5 from the cytoplasm when activated by PlGF ( n = 3). Scale bar: 20 μm. Data represented as arithmetic mean ± SEM. Significance was determined using student’s unpaired two-tailed t-test with Welch’s correction method. n represents the number of independent experiments (biological replicates)

Article Snippet: After incubation with 5% non-fat milk or BSA in TBST (10 mM Tris, pH 8.0, 150 mM NaCl, 0.5% Tween 20) for 60 min, the membrane was washed once with TBST and incubated with primary antibodies against NFAT5 (1:2000, #NB20-3446, Novus Biologicals) [ ], SGK1 (1:1000, #07-315, Merck) [ ], phospho-SGK1 (1:1000, #36 − 002, Merck) [ ], p38 MAPK (1:1000, #8690S, Cell Signaling Technologies) [ ], phospho-p38 MAPK (1:1000, #4511, Cell Signaling Technologies) [ ], VEGF-A (1:3000, #ab46154, abcam) [ ], VEGFR1 (1:1000, #2893, Cell Signaling Technologies) [ ], VEGFR2 (1:1000, #2479, Cell Signaling Technologies) [ ], or GAPDH (1:1000, #5174, Cell Signaling Technologies) [ ] at 4 °C for overnight.

Techniques: Expressing, Activity Assay, Concentration Assay, Western Blot, Control, Immunofluorescence, Translocation Assay, Two Tailed Test

Journal: Biological Research

Article Title: Placental growth factor mediates pathological uterine angiogenesis by activating the NFAT5-SGK1 signaling axis in the endometrium: implications for preeclampsia development

doi: 10.1186/s40659-024-00526-w

Figure Lengend Snippet: PlGF-NFAT5 angiogenic signaling axis in EnSCs. ( a ) Original Western blots of total and phosphorylated levels of p38 MAPK, SGK1 and total VEGF-A targets with GAPDH as loading control in untreated (Con)and PlGF treated EnSCs. ( b - e ) Average protein expression levels of total and phosphorylated levels of p38 MAPK and SGK1 targets in untreated (Con) and PlGF treated EnSCs ( n = 5, *, p < 0.05). ( f ) qPCR analysis of HIF-1α transcript levels in untreated (Con) and PlGF treated EnSCs. L19 was used as a housekeeping gene ( n = 5, *, p < 0.05). ( g ) Luciferase reporter assay measuring the HIF-1α promoter activity in untreated (Con), PlGF and DMOG (positive control for hypoxia, 0.5 mM for 24 h) treated EnSCs ( n = 5, ***, p < 0.001, ****, p < 0.0001). ( h ) Immunoblotting showing average protein expression levels of VEGF-A (Con) in untreated and PlGF treated EnSCs ( n = 5, **, p < 0.01). ( i ) Supernatant from untreated (Con) and PlGF treated EnSCs was collected and secreted VEGF-A levels were quantified with ELISA ( n = 5, *, p < 0.05). Data represented here as arithmetic mean ± SEM. The treatment samples groups (PlGF) are represented after normalization with untreated control (Con). Significance was determined using student’s unpaired two-tailed t-test with Welch’s correction method. n represents the number of independent experiments (biological replicates)

Article Snippet: After incubation with 5% non-fat milk or BSA in TBST (10 mM Tris, pH 8.0, 150 mM NaCl, 0.5% Tween 20) for 60 min, the membrane was washed once with TBST and incubated with primary antibodies against NFAT5 (1:2000, #NB20-3446, Novus Biologicals) [ ], SGK1 (1:1000, #07-315, Merck) [ ], phospho-SGK1 (1:1000, #36 − 002, Merck) [ ], p38 MAPK (1:1000, #8690S, Cell Signaling Technologies) [ ], phospho-p38 MAPK (1:1000, #4511, Cell Signaling Technologies) [ ], VEGF-A (1:3000, #ab46154, abcam) [ ], VEGFR1 (1:1000, #2893, Cell Signaling Technologies) [ ], VEGFR2 (1:1000, #2479, Cell Signaling Technologies) [ ], or GAPDH (1:1000, #5174, Cell Signaling Technologies) [ ] at 4 °C for overnight.

Techniques: Western Blot, Control, Expressing, Luciferase, Reporter Assay, Activity Assay, Positive Control, Enzyme-linked Immunosorbent Assay, Two Tailed Test

Journal: Biological Research

Article Title: Placental growth factor mediates pathological uterine angiogenesis by activating the NFAT5-SGK1 signaling axis in the endometrium: implications for preeclampsia development

doi: 10.1186/s40659-024-00526-w

Figure Lengend Snippet: Angiogenic effect of PlGF-NFAT5 signaling axis on HUVECs. ( a ) Schematics describing the experimental approach of CM treatment on HUVECs. ( b ) BrdU incorporated ELISA analysis for cell proliferation measured in Con-CM and PlGF-CM treated HUVECs ( n = 4, *, p < 0.05). ( c ) Representative fluorescence microscopic images of wound healing scratch assay on Con-CM and PlGF-CM treated HUVECs at 0 and 24 h ( n = 4). Yellow line represents the wound area created. Scale bar: 650 μm. ( d ) Wound closure rate in Con-CM and PlGF-CM treated HUVECs at 24 h ( n = 4, **, p < 0.01) explain normalization. ( e ) Representative fluorescence microscopic images of tube formation assay on a matrigel with Con-CM, PlGF-CM and DMOG (positive control; 0.5 mM for 24 h) treated HUVECs at 24 h ( n = 4). The insert displays HUVECs seeded on the matrigel at 0 h. Scale bar: 650 μm. ( f ) Tube formation assay analysis showing tube length in Con-CM, PlGF-CM and DMOG treated HUVECs at 24 h ( n = 4). ( g ) Tube formation assay analysis depicting number of branches in Con-CM, PlGF-CM and DMOG treated HUVECs at 24 h ( n = 4, *, p < 0.05). ( h - l ) qPCR analysis of Notch receptors ( Notch 1 and Notch 2 ), ligands ( Dll4 and Jagged-1 ) and target genes ( Hey 1 ) in Con-CM and PlGF-CM treated HUVECs. L19 was used as a housekeeping control. ( n = 4, *, p < 0.05, **, p < 0.01). ( m ) Original Western blots of VEGFR1, VEGFR2 and VEGF-A targets with GAPDH as loading control in Con-CM and PlGF-CM treated HUVECs. ( n ) Average protein levels of VEGFR1, VEGFR2 and VEGF-A in Con-CM and PlGF-CM treated HUVECs ( n = 4, *, p < 0.05, **, p < 0.01). Data represented here as arithmetic mean ± SEM. The treatment samples groups (PlGF-CM) are represented after normalization with control (Con-CM). Significance was determined using student’s unpaired two-tailed t-test with Welch’s correction method. ( o ) EIS analysis of cell impedance values in Con-CM and PlGF-CM treated HUVEC monolayer representing endothelial barrier function ( n = 4, ****, p < 0.0001). Significance was determined using student’s unpaired two-tailed t-test with Welch’s correction method for cell impedance values at 4 h. n represents the number of independent experiments (biological replicates)

Article Snippet: After incubation with 5% non-fat milk or BSA in TBST (10 mM Tris, pH 8.0, 150 mM NaCl, 0.5% Tween 20) for 60 min, the membrane was washed once with TBST and incubated with primary antibodies against NFAT5 (1:2000, #NB20-3446, Novus Biologicals) [ ], SGK1 (1:1000, #07-315, Merck) [ ], phospho-SGK1 (1:1000, #36 − 002, Merck) [ ], p38 MAPK (1:1000, #8690S, Cell Signaling Technologies) [ ], phospho-p38 MAPK (1:1000, #4511, Cell Signaling Technologies) [ ], VEGF-A (1:3000, #ab46154, abcam) [ ], VEGFR1 (1:1000, #2893, Cell Signaling Technologies) [ ], VEGFR2 (1:1000, #2479, Cell Signaling Technologies) [ ], or GAPDH (1:1000, #5174, Cell Signaling Technologies) [ ] at 4 °C for overnight.

Techniques: Enzyme-linked Immunosorbent Assay, Fluorescence, Wound Healing Assay, Tube Formation Assay, Positive Control, Control, Western Blot, Two Tailed Test

Journal: Biological Research

Article Title: Placental growth factor mediates pathological uterine angiogenesis by activating the NFAT5-SGK1 signaling axis in the endometrium: implications for preeclampsia development

doi: 10.1186/s40659-024-00526-w

Figure Lengend Snippet: Graphical abstract describing the effect of pathological PlGF levels in altered uterine endometrial angiogenesis and its plausible role in PE pathology. Aberrant levels of endometrial PlGF activates NFAT5-SGK1-VEGF-A signaling axis in uterine stromal cells. Activation of this signaling cascade presents negative angiogenic cues to endothelial cells, with deregulated secreted protein cargo (decreased angiogenic factor VEGF-A and increased ECM associated proteins). PlGF mediated secreted factors supports abnormal vessel development in HUVECs, with dysregulation of Notch-VEGF signaling. Aberrant PlGF triggered stromal-endothelial paracrine signaling results in hypersprouting, high cellular resistance and impaired BeWo invasion through HUEVCs. Hypersprouting and high cellular impedance in HUVECs confirm pathological uterine vascularization upon deregulated endometrial PlGF. Thus, we postulate such aberrant uterine angiogenesis prior to pregnancy will likely lead to poor quality maternal vessels, inadequate trophoblast invasion causing poor placentation as seen in PE pregnancy (Images created with BioRender)

Article Snippet: After incubation with 5% non-fat milk or BSA in TBST (10 mM Tris, pH 8.0, 150 mM NaCl, 0.5% Tween 20) for 60 min, the membrane was washed once with TBST and incubated with primary antibodies against NFAT5 (1:2000, #NB20-3446, Novus Biologicals) [ ], SGK1 (1:1000, #07-315, Merck) [ ], phospho-SGK1 (1:1000, #36 − 002, Merck) [ ], p38 MAPK (1:1000, #8690S, Cell Signaling Technologies) [ ], phospho-p38 MAPK (1:1000, #4511, Cell Signaling Technologies) [ ], VEGF-A (1:3000, #ab46154, abcam) [ ], VEGFR1 (1:1000, #2893, Cell Signaling Technologies) [ ], VEGFR2 (1:1000, #2479, Cell Signaling Technologies) [ ], or GAPDH (1:1000, #5174, Cell Signaling Technologies) [ ] at 4 °C for overnight.

Techniques: Activation Assay

Journal: Molecular Vision

Article Title: Involvement of TonEBP/NFAT5 in osmoadaptative response of human retinal pigmented epithelial cells to hyperosmolar stress

doi:

Figure Lengend Snippet: Kinetics of TonEBP expression in ARPE-19 cells exposed to hyperosmolar stress. A , B : ARPE-19 cells were incubated for 0, 1, 2, 4, 8, 12, or 24 h with iso-osmolar medium (control) or media containing the additional presence of 100 mM NaCl (Na100) or 200 mM sucrose (Su200). C : ARPE-19 cells were incubated for 4 h under iso-osmolar or hyperosmolar medium (Na100 or Su200), after which 1 µg/ml of actinomycin D (ActD) was added. Tonicity enhancer binding protein (TonEBP) mRNA levels were determined with real-time quantitative PCR (RT-qPCR) at 0, 2, 4, 6, and 8 h following the addition of ActD. A , C : TonEBP mRNA levels were measured with RT-qPCR as described in the Methods section. Data are expressed as relative TonEBP mRNA levels (in fold stimulation) to the 0 h time point set to 1. Data are the mean ± standard error of the mean (SEM; n=3) and are expressed as TonEBP mRNA levels following normalization with appropriate reference genes ( HPRT1 , B2M , ATP5B ). Data were analyzed using repeated-measures ANOVA and Dunnett’s post-hoc tests. *: p<0.05 and **p <0.01 indicate statistical significance compared to time 0 h. B : The TonEBP protein levels were determined with semiquantitative western blot analysis. β-actin was used as an internal control of protein expression. Data are representative of three independent experiments.

Article Snippet: ARPE-19 cells were incubated overnight at 4 °C with the primary antibodies against TonEBP (Novus Biologicals, Littleton, CO, dilution 1:200), followed by incubation with biotinylated anti-rabbit immunoglobulin (IgG; GE Healthcare UK Limited, Buckinghamshire, UK, dilution 1:600) and streptavidin-cyanin2 (Jackson Immunoresearch Laboratories, West Grove, PA, dilution 1:200).

Techniques: Expressing, Incubation, Control, Binding Assay, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot

Journal: Molecular Vision

Article Title: Involvement of TonEBP/NFAT5 in osmoadaptative response of human retinal pigmented epithelial cells to hyperosmolar stress

doi:

Figure Lengend Snippet: Kinetics of TonEBP nuclear translocation in ARPE-19 cells exposed to hyperosmolar stress. ARPE-19 cells were incubated for 4, 8, or 12 h with iso-osmolar medium (control) or media containing the additional presence of 100 mM NaCl (Na100) or 200 mM sucrose (Su200). Cells were then fixed and exposed to immunofluorescent staining of tonicity enhancer binding protein (TonEBP) (in green) as described in the Methods section. A : Negative control (CTNeg) was performed in the sole presence of secondary antibodies. B : Cells were incubated under iso-osmolar conditions for 0 h (CT). C , E , G : Cells were incubated with Na100. D , F , H : Cells were incubated with Su200. Cell nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; blue). Scale bars represent 20 µm. Pictures were taken at 40X magnification. Data are representative of three independent experiments.

Article Snippet: ARPE-19 cells were incubated overnight at 4 °C with the primary antibodies against TonEBP (Novus Biologicals, Littleton, CO, dilution 1:200), followed by incubation with biotinylated anti-rabbit immunoglobulin (IgG; GE Healthcare UK Limited, Buckinghamshire, UK, dilution 1:600) and streptavidin-cyanin2 (Jackson Immunoresearch Laboratories, West Grove, PA, dilution 1:200).

Techniques: Translocation Assay, Incubation, Control, Staining, Binding Assay, Negative Control

Journal: Molecular Vision

Article Title: Involvement of TonEBP/NFAT5 in osmoadaptative response of human retinal pigmented epithelial cells to hyperosmolar stress

doi:

Figure Lengend Snippet: Dose–response curve of hyperosmolar stress on TonEBP expression in ARPE-19 cells. ARPE-19 cells were incubated for 12 h with iso-osmolar medium (control) or media containing the additional presence of increasing concentrations of NaCl (Na25, Na50, Na100) or sucrose (Su50, Su100, Su200). A : Tonicity enhancer binding protein (TonEBP) mRNA levels measured with real-time quantitative PCR (RT-qPCR) under increasing concentrations of NaCl. B : TonEBP mRNA levels measured with RT-qPCR under increasing concentrations of sucrose. A , B : Data are expressed as relative TonEBP mRNA levels (in fold stimulation) over the iso-osmolar condition (Na0 or Su0) set to 1. The data are the mean ± standard error of the mean (SEM; n=3) following normalization with the appropriate reference genes ( HPRT1 , B2M , ATP5B ). Data were analyzed using repeated-measures ANOVA and Dunnett’s post-hoc tests. *: p<0.05 and **p <0.01 indicate statistical significance compared to the iso-osmolar medium (Na0 or Su0). C : The TonEBP protein levels were determined with semiquantitative western blot analysis. β-actin was used as an internal control of protein expression. Data are representative of three independent experiments.

Article Snippet: ARPE-19 cells were incubated overnight at 4 °C with the primary antibodies against TonEBP (Novus Biologicals, Littleton, CO, dilution 1:200), followed by incubation with biotinylated anti-rabbit immunoglobulin (IgG; GE Healthcare UK Limited, Buckinghamshire, UK, dilution 1:600) and streptavidin-cyanin2 (Jackson Immunoresearch Laboratories, West Grove, PA, dilution 1:200).

Techniques: Expressing, Incubation, Control, Binding Assay, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot

Journal: Molecular Vision

Article Title: Involvement of TonEBP/NFAT5 in osmoadaptative response of human retinal pigmented epithelial cells to hyperosmolar stress

doi:

Figure Lengend Snippet: Dose–response curve of hyperosmolar stress on TonEBP nuclear translocation in ARPE-19 cells. ARPE-19 cells were incubated for 4 h with iso-osmolar medium (CT). Cells were incubated for 4 h in media containing the additional presence of increasing concentrations of NaCl (Na25, Na50, Na100; C , E , G ) or sucrose (Su50, Su100, Su200; D , F , H ). Negative control (CTNeg) was performed in the sole presence of secondary antibodies. Cells were then fixed and exposed to immunofluorescent staining of tonicity enhancer binding protein (TonEBP) (in green) as described in the Methods section. Cell nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; blue). Scale bars represent 20 µm. Pictures were taken at 40X magnification. Data are representative of three independent experiments.

Article Snippet: ARPE-19 cells were incubated overnight at 4 °C with the primary antibodies against TonEBP (Novus Biologicals, Littleton, CO, dilution 1:200), followed by incubation with biotinylated anti-rabbit immunoglobulin (IgG; GE Healthcare UK Limited, Buckinghamshire, UK, dilution 1:600) and streptavidin-cyanin2 (Jackson Immunoresearch Laboratories, West Grove, PA, dilution 1:200).

Techniques: Translocation Assay, Incubation, Negative Control, Staining, Binding Assay

Journal: Molecular Vision

Article Title: Involvement of TonEBP/NFAT5 in osmoadaptative response of human retinal pigmented epithelial cells to hyperosmolar stress

doi:

Figure Lengend Snippet: Effects of DN-TonEBP on the transactivation activity of TonEBP. ARPE-19 cells were transiently transfected with either 10 µg of pSEAP-TonE plasmid and 10 µg of pcDNA3.1 plasmid (control plasmid) or with 10 µg of pSEAP-TonE plasmid and 10 µg of DN-TonEBP plasmid, before being incubated for 24 h in the absence (control) or presence of 100 mM additional NaCl (Na100). The activity of secreted embryonic alkaline phosphatase (SEAP) was measured with luminescence in the cell culture supernatant. Data are expressed as relative activity (in fold stimulation) over the iso-osmolar condition and are the mean ± standard error of the mean (SEM; n=3). Statistical analysis was performed with the conformity t test (###p<0.005) that compared the control in Na100 to the control in the iso-osmolar condition, and a paired t test (***p<0.005) was used to compare the dominant negative form of tonicity enhancer binding protein (DN-TonEBP) TonEBP in Na100 to DN-TonEBP in the iso-osmolar condition.

Article Snippet: ARPE-19 cells were incubated overnight at 4 °C with the primary antibodies against TonEBP (Novus Biologicals, Littleton, CO, dilution 1:200), followed by incubation with biotinylated anti-rabbit immunoglobulin (IgG; GE Healthcare UK Limited, Buckinghamshire, UK, dilution 1:600) and streptavidin-cyanin2 (Jackson Immunoresearch Laboratories, West Grove, PA, dilution 1:200).

Techniques: Activity Assay, Transfection, Plasmid Preparation, Control, Incubation, Cell Culture, Dominant Negative Mutation, Binding Assay

Journal: Molecular Vision

Article Title: Involvement of TonEBP/NFAT5 in osmoadaptative response of human retinal pigmented epithelial cells to hyperosmolar stress

doi:

Figure Lengend Snippet: Effects of DN-TonEBP on NaCl-induced TauT and AR expression. ARPE-19 cells transiently transfected with either H 2 O or 10 µg of DN-TonEBP were incubated for 8 h with iso-osmolar medium (control, CT) or media containing the additional presence of 100 mM NaCl (Na100). ( A ) Aldose reductase (AR) and ( B ) sodium-dependent taurine transporter (TauT) mRNA levels were measured with real-time quantitative PCR (RT-qPCR) as described in the Methods section. The data are the mean ± standard error of the mean (SEM; n=5) and are expressed as gene mRNA levels (in fold stimulation) over the iso-osmolar condition set to 1 for H 2 O and a dominant negative form of tonicity enhancer binding protein (DN-TonEBP) following normalization with the appropriate reference genes ( YWHAZ , ATP5B , MDH1 ). Statistical analysis was performed with the conformity t test (#p<0.05; ##p<0.01) that compared the Na100 condition to the iso-osmolar condition, and a paired t test (*p<0.05) as used to compare DN-TonEBP in Na100 to DN-TonEBP in the iso-osmolar condition.

Article Snippet: ARPE-19 cells were incubated overnight at 4 °C with the primary antibodies against TonEBP (Novus Biologicals, Littleton, CO, dilution 1:200), followed by incubation with biotinylated anti-rabbit immunoglobulin (IgG; GE Healthcare UK Limited, Buckinghamshire, UK, dilution 1:600) and streptavidin-cyanin2 (Jackson Immunoresearch Laboratories, West Grove, PA, dilution 1:200).

Techniques: Expressing, Transfection, Incubation, Control, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Dominant Negative Mutation, Binding Assay

Journal: Molecular Vision

Article Title: Involvement of TonEBP/NFAT5 in osmoadaptative response of human retinal pigmented epithelial cells to hyperosmolar stress

doi:

Figure Lengend Snippet: Involvement of p38 protein kinase in TonEBP activation and subsequent transactivation activity induced by hyperosmolar stress in ARPE-19 cells. Cells were preincubated for 1 h in the presence of 0.1% dimethyl sulfoxide (DMSO) or 10 µM SB203580 and then incubated for various times with iso-osmolar medium (CT; open columns) or medium containing the additional presence of 100 mM NaCl (Na100; closed columns). ( A ) Tonicity enhancer binding protein (TonEBP) translocation, ( B ) secreted embryonic alkaline phosphatase (SEAP) activity, and ( C ) quantification of aldose reductase (AR) and ( D ) sodium-dependent taurine transporter (TauT) mRNA levels were performed following 4, 24, 8, and 8 h incubation, respectively, as described in the Methods section. A : TonEBP was labeled in green, while cell nuclei were labeled in blue. Scale bars represent 20 µm. Pictures were taken at 40X magnification. Data are representative of three independent experiments. B : SEAP data are expressed as relative activity (in fold stimulation) over the control (DMSO) in Na100 and are the mean ± standard error of the mean (SEM; n=3). C , D : Data are expressed as relative gene mRNA levels (in fold stimulation) over the DMSO iso-osmolar condition set to 1. The data are the mean ± SEM (n=3) and are expressed as gene mRNA levels following normalization with the appropriate reference genes ( HPRT1 , B2M , ATP5B ). B , C , D : Statistical analysis was performed using the conformity t test (*p<0.05) that compared SB203580 Na100 with control Na100, a paired t test (#p<0.05, ###p<0.005) that compared SB203580 Na100 with SB203580 in the iso-osmolar condition, and a second paired t test that compared DMSO in the iso-osmolar condition and SB203580 in the iso-osmolar condition.

Article Snippet: ARPE-19 cells were incubated overnight at 4 °C with the primary antibodies against TonEBP (Novus Biologicals, Littleton, CO, dilution 1:200), followed by incubation with biotinylated anti-rabbit immunoglobulin (IgG; GE Healthcare UK Limited, Buckinghamshire, UK, dilution 1:600) and streptavidin-cyanin2 (Jackson Immunoresearch Laboratories, West Grove, PA, dilution 1:200).

Techniques: Activation Assay, Activity Assay, Incubation, Binding Assay, Translocation Assay, Labeling, Control